ID: 912212251_912212256

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 912212251 912212256
Species Human (GRCh38) Human (GRCh38)
Location 1:107568892-107568914 1:107568931-107568953
Sequence CCTGCCATCTTCTGCAGATAACT ACAGCTCTTGGATTGCTACTGGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 38, 3: 280, 4: 378}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!