ID: 912542236_912542251

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 912542236 912542251
Species Human (GRCh38) Human (GRCh38)
Location 1:110425803-110425825 1:110425852-110425874
Sequence CCAGGCTCAGCCCCATCCTGGTG CCGGCTACTTCACTTGGCCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 43, 4: 507} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!