ID: 912968675_912968688

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 912968675 912968688
Species Human (GRCh38) Human (GRCh38)
Location 1:114259942-114259964 1:114259994-114260016
Sequence CCAATGTCCACATTGAAACTCTG CACCACACTGAGGTGGGAGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 48, 4: 407}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!