ID: 913182156_913182164

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 913182156 913182164
Species Human (GRCh38) Human (GRCh38)
Location 1:116332782-116332804 1:116332826-116332848
Sequence CCTGGGGTGGGTCCAGAGCACTG GTGATGTGCATAGGCAGATAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!