ID: 913507765_913507770

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 913507765 913507770
Species Human (GRCh38) Human (GRCh38)
Location 1:119533934-119533956 1:119533977-119533999
Sequence CCCAAGATGCCCTCGAAGGGGAA TTTCTTGATGTCATCATTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78} {0: 1, 1: 1, 2: 15, 3: 76, 4: 556}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!