ID: 913611147_913611149

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 913611147 913611149
Species Human (GRCh38) Human (GRCh38)
Location 1:120510951-120510973 1:120510969-120510991
Sequence CCTCTACTCAAGTCAAACCTCAC CTCACAACAAACCACACTGAAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 7, 4: 98} {0: 2, 1: 1, 2: 2, 3: 15, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!