ID: 913686169_913686171

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 913686169 913686171
Species Human (GRCh38) Human (GRCh38)
Location 1:121234184-121234206 1:121234206-121234228
Sequence CCTATAAAGATTCTTTAAAGAGT TAATACCCTGAGTGGTTTTCTGG
Strand - +
Off-target summary {0: 4, 1: 10, 2: 10, 3: 46, 4: 384} {0: 5, 1: 0, 2: 0, 3: 7, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!