ID: 913693291_913693294

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 913693291 913693294
Species Human (GRCh38) Human (GRCh38)
Location 1:121300129-121300151 1:121300179-121300201
Sequence CCTAGATACATGTGCATACAAAT ATGCTGTAAATAAATACCTGAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 2, 3: 18, 4: 308} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!