ID: 913694988_913694995

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 913694988 913694995
Species Human (GRCh38) Human (GRCh38)
Location 1:121316124-121316146 1:121316159-121316181
Sequence CCCAGGGACGGGTATTTGGGAGG TGGATACCCTTTCTTCTCAGTGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 1, 3: 10, 4: 107} {0: 3, 1: 0, 2: 1, 3: 12, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!