ID: 913742998_913743013

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 913742998 913743013
Species Human (GRCh38) Human (GRCh38)
Location 1:121870104-121870126 1:121870132-121870154
Sequence CCCCAGCCCTGGAAGCCTCCAAA CCTTGGAATGTTGAAAAGGGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!