ID: 914146622_914146627

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 914146622 914146627
Species Human (GRCh38) Human (GRCh38)
Location 1:145000854-145000876 1:145000886-145000908
Sequence CCCACAGGCTCTGTTGCCAGCAC ATCAGCCCGCGCTCCCCATTGGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 0, 3: 1, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!