ID: 914152734_914152738

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 914152734 914152738
Species Human (GRCh38) Human (GRCh38)
Location 1:145058022-145058044 1:145058062-145058084
Sequence CCAAGGAATGGAAGAAGTAACAT GGTCAGGTTCAGCAGCCCTATGG
Strand - +
Off-target summary No data {0: 4, 1: 0, 2: 1, 3: 5, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!