ID: 914490222_914490234

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 914490222 914490234
Species Human (GRCh38) Human (GRCh38)
Location 1:148146932-148146954 1:148146959-148146981
Sequence CCCTGGGGGCAGCTCAGCCTGGG CCCAAGAGGGGACCAGGCGGGGG
Strand - +
Off-target summary {0: 6, 1: 1, 2: 9, 3: 60, 4: 426} {0: 2, 1: 2, 2: 8, 3: 15, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!