ID: 914490224_914490226

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 914490224 914490226
Species Human (GRCh38) Human (GRCh38)
Location 1:148146933-148146955 1:148146946-148146968
Sequence CCTGGGGGCAGCTCAGCCTGGGC CAGCCTGGGCACACCCAAGAGGG
Strand - +
Off-target summary {0: 7, 1: 5, 2: 11, 3: 70, 4: 491} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!