ID: 914545104_914545107

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 914545104 914545107
Species Human (GRCh38) Human (GRCh38)
Location 1:148657228-148657250 1:148657267-148657289
Sequence CCTCTTTCCTTCAAGCACAGCAG CATCTTTATCTGCAGACTTTGGG
Strand - +
Off-target summary {0: 5, 1: 0, 2: 4, 3: 31, 4: 272} {0: 5, 1: 0, 2: 1, 3: 13, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!