ID: 914829378_914829388

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 914829378 914829388
Species Human (GRCh38) Human (GRCh38)
Location 1:151159557-151159579 1:151159588-151159610
Sequence CCCCCTCCCATGTGAACCAAGGA ACAGCCCAGAGAACCCCTTTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 177} {0: 1, 1: 0, 2: 1, 3: 14, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!