ID: 914829379_914829389

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 914829379 914829389
Species Human (GRCh38) Human (GRCh38)
Location 1:151159558-151159580 1:151159589-151159611
Sequence CCCCTCCCATGTGAACCAAGGAA CAGCCCAGAGAACCCCTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 143} {0: 1, 1: 0, 2: 1, 3: 17, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!