ID: 914829390_914829399

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 914829390 914829399
Species Human (GRCh38) Human (GRCh38)
Location 1:151159592-151159614 1:151159617-151159639
Sequence CCCAGAGAACCCCTTTGGGGATA AAAGACAGAAGAGGGGAAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 100} {0: 1, 1: 1, 2: 27, 3: 260, 4: 2103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!