ID: 915165696_915165709

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 915165696 915165709
Species Human (GRCh38) Human (GRCh38)
Location 1:153946641-153946663 1:153946675-153946697
Sequence CCCCGCTCCGGGCCGCGGGCGCC CACCCCTCCTCCTCGGCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 49, 4: 371} {0: 1, 1: 0, 2: 1, 3: 22, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!