ID: 915352653_915352657

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 915352653 915352657
Species Human (GRCh38) Human (GRCh38)
Location 1:155235966-155235988 1:155235991-155236013
Sequence CCTTAGTAGCTAAGGAGTTGGGG GTGAAGATCCAGGCATCTCAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 11, 4: 89} {0: 2, 1: 0, 2: 3, 3: 8, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!