ID: 915544913_915544916

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 915544913 915544916
Species Human (GRCh38) Human (GRCh38)
Location 1:156591725-156591747 1:156591745-156591767
Sequence CCGGCCTCTTCGGGGGCGGGGCG GCGAGCGCCGCACATGCGCCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 153} {0: 1, 1: 0, 2: 0, 3: 1, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!