ID: 916106327_916106330

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 916106327 916106330
Species Human (GRCh38) Human (GRCh38)
Location 1:161435291-161435313 1:161435325-161435347
Sequence CCAGTAACAGGCCAAGAGCTGTC GAGTAGTTATTTGCAGAAGATGG
Strand - +
Off-target summary No data {0: 11, 1: 189, 2: 190, 3: 139, 4: 322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!