ID: 916839006_916839011

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 916839006 916839011
Species Human (GRCh38) Human (GRCh38)
Location 1:168580344-168580366 1:168580397-168580419
Sequence CCAACCGAATAGCGATTATTGCA TCCTCCTCTATTTAGCTTAGTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 3, 4: 29} {0: 1, 1: 0, 2: 1, 3: 12, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!