ID: 917118045_917118061

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 917118045 917118061
Species Human (GRCh38) Human (GRCh38)
Location 1:171622259-171622281 1:171622310-171622332
Sequence CCCCTGCTCTGCCCCCAAGACCC TTCTCAAGGACACGGCTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 83, 4: 612} {0: 1, 1: 0, 2: 2, 3: 15, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!