ID: 917306117_917306127

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 917306117 917306127
Species Human (GRCh38) Human (GRCh38)
Location 1:173627414-173627436 1:173627467-173627489
Sequence CCCCATACCCCTGGTAATAGCCA AGGGAGAGCACAGTGACTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 142} {0: 10, 1: 58, 2: 101, 3: 188, 4: 480}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!