|
Left Crispr |
Right Crispr |
Crispr ID |
917376254 |
917376264 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:174351016-174351038
|
1:174351052-174351074
|
Sequence |
CCGAGATGGCAGCAGTACAGTCC |
CATGAGAGGGAGACCGTGGGGGG |
Strand |
- |
+ |
Off-target summary |
{0: 791, 1: 492, 2: 154, 3: 345, 4: 7246} |
{0: 2, 1: 3, 2: 97, 3: 184, 4: 1356} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|