ID: 917403529_917403535

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 917403529 917403535
Species Human (GRCh38) Human (GRCh38)
Location 1:174678895-174678917 1:174678931-174678953
Sequence CCGGAGGGATGGAAGTCAGCAGT TGGCAAACAGCAGTGGTGGATGG
Strand - +
Off-target summary {0: 7, 1: 34, 2: 76, 3: 118, 4: 311} {0: 41, 1: 78, 2: 97, 3: 99, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!