ID: 917755421_917755433

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 917755421 917755433
Species Human (GRCh38) Human (GRCh38)
Location 1:178093876-178093898 1:178093908-178093930
Sequence CCGGAGCTGTGGCCTGAGAGTCA CAGGCTCATTCCAGAAGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 289} {0: 1, 1: 0, 2: 1, 3: 17, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!