ID: 918108593_918108596

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 918108593 918108596
Species Human (GRCh38) Human (GRCh38)
Location 1:181435170-181435192 1:181435191-181435213
Sequence CCCCTAGAGAGCTAGTTGTTAAA AATGTTTACCAGCACACCACTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 40, 3: 66, 4: 256} {0: 3, 1: 13, 2: 40, 3: 127, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!