|
Left Crispr |
Right Crispr |
Crispr ID |
918647189 |
918647197 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:186918346-186918368
|
1:186918377-186918399
|
Sequence |
CCCCCAGAGTTTAACAGGCCCTT |
ATAATGCTCCATGCACTTGGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 8, 1: 9, 2: 41, 3: 41, 4: 101} |
{0: 11, 1: 19, 2: 26, 3: 38, 4: 114} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|