ID: 919748610_919748618

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 919748610 919748618
Species Human (GRCh38) Human (GRCh38)
Location 1:201023435-201023457 1:201023451-201023473
Sequence CCAATGCCCGAGGCAGCGGCTGC CGGCTGCGGCTGCGGGAGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 176} {0: 1, 1: 0, 2: 9, 3: 66, 4: 607}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!