ID: 919748612_919748622

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 919748612 919748622
Species Human (GRCh38) Human (GRCh38)
Location 1:201023441-201023463 1:201023459-201023481
Sequence CCCGAGGCAGCGGCTGCGGCTGC GCTGCGGGAGGCGGGGGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 113, 4: 683} {0: 1, 1: 1, 2: 12, 3: 133, 4: 1086}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!