ID: 919865237_919865241

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 919865237 919865241
Species Human (GRCh38) Human (GRCh38)
Location 1:201776878-201776900 1:201776920-201776942
Sequence CCACACCAAGGCACATCATTAGC AGATGCTAAAAGTTCCAGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 56, 4: 287} {0: 1, 1: 0, 2: 0, 3: 15, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!