ID: 920039323_920039344

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 920039323 920039344
Species Human (GRCh38) Human (GRCh38)
Location 1:203085490-203085512 1:203085539-203085561
Sequence CCCCTGGCTGGGGCCCGCCCCCG CTGGTTGAGGGAGCTGAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 346} {0: 1, 1: 1, 2: 1, 3: 35, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!