ID: 920197429_920197434

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 920197429 920197434
Species Human (GRCh38) Human (GRCh38)
Location 1:204238364-204238386 1:204238403-204238425
Sequence CCTGCCATCTTCTGCAGCTAACT ACACCTGTTGGTCTGTTACTGGG
Strand - +
Off-target summary {0: 3, 1: 196, 2: 185, 3: 125, 4: 341} {0: 1, 1: 0, 2: 24, 3: 248, 4: 351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!