|
Left Crispr |
Right Crispr |
| Crispr ID |
920197429 |
920197436 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:204238364-204238386
|
1:204238409-204238431
|
| Sequence |
CCTGCCATCTTCTGCAGCTAACT |
GTTGGTCTGTTACTGGGCTTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 196, 2: 185, 3: 125, 4: 341} |
{0: 2, 1: 20, 2: 194, 3: 181, 4: 246} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|