ID: 920463186_920463189

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 920463186 920463189
Species Human (GRCh38) Human (GRCh38)
Location 1:206158003-206158025 1:206158042-206158064
Sequence CCTTCAAAGTCAGGAGCTACATG CATCAGCTAAAAGACACCCTAGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 0, 3: 8, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!