ID: 920474305_920474314

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 920474305 920474314
Species Human (GRCh38) Human (GRCh38)
Location 1:206259963-206259985 1:206260006-206260028
Sequence CCCTTTACAGAAGTTCATTATGA CATTGTAAAGGGAGTAGGGAAGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 1, 3: 20, 4: 237} {0: 4, 1: 0, 2: 2, 3: 25, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!