ID: 920674598_920674614

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 920674598 920674614
Species Human (GRCh38) Human (GRCh38)
Location 1:208030387-208030409 1:208030436-208030458
Sequence CCTGAAGTGCCCTCTCCCAGCGC GGGACAGGCATGTGCTGTCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 20, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!