ID: 920674604_920674615

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 920674604 920674615
Species Human (GRCh38) Human (GRCh38)
Location 1:208030397-208030419 1:208030437-208030459
Sequence CCTCTCCCAGCGCTGGGCCGGGG GGACAGGCATGTGCTGTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 48, 4: 431} {0: 1, 1: 0, 2: 1, 3: 19, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!