ID: 921097836_921097838

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 921097836 921097838
Species Human (GRCh38) Human (GRCh38)
Location 1:211902092-211902114 1:211902117-211902139
Sequence CCTCTCTGCTGAGAGCAGCAGAT CAGGATGACCAGCTGCAGAGTGG
Strand - +
Off-target summary {0: 5, 1: 31, 2: 108, 3: 264, 4: 700} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!