ID: 921484873_921484880

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 921484873 921484880
Species Human (GRCh38) Human (GRCh38)
Location 1:215703765-215703787 1:215703792-215703814
Sequence CCACTGAGCAAGACCACACGGCT GGCTTCAGCCCCCTTTTCAGGGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 122, 3: 406, 4: 457} {0: 26, 1: 515, 2: 564, 3: 341, 4: 361}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!