|
Left Crispr |
Right Crispr |
| Crispr ID |
921516767 |
921516774 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:216102704-216102726
|
1:216102755-216102777
|
| Sequence |
CCAGGAGAATGGTGTGAACCCGA |
GCGCCACTGCACTCCAGCCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 20, 2: 163, 3: 251, 4: 478} |
{0: 47841, 1: 174825, 2: 232776, 3: 176871, 4: 95097} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|