ID: 922056314_922056320

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 922056314 922056320
Species Human (GRCh38) Human (GRCh38)
Location 1:222045569-222045591 1:222045610-222045632
Sequence CCCTGGAGTTTGTTAAGATGATG ACCAGATGTAGGCCACGTTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 4, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!