ID: 922101588_922101603

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 922101588 922101603
Species Human (GRCh38) Human (GRCh38)
Location 1:222481816-222481838 1:222481867-222481889
Sequence CCCACCCAGCAACTCCCTGGCCT TCTCAACACCACCACGACCCTGG
Strand - +
Off-target summary {0: 13, 1: 31, 2: 9, 3: 48, 4: 425} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!