ID: 922101589_922101603

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 922101589 922101603
Species Human (GRCh38) Human (GRCh38)
Location 1:222481817-222481839 1:222481867-222481889
Sequence CCACCCAGCAACTCCCTGGCCTC TCTCAACACCACCACGACCCTGG
Strand - +
Off-target summary {0: 13, 1: 10, 2: 11, 3: 65, 4: 829} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!