|
Left Crispr |
Right Crispr |
| Crispr ID |
922683923 |
922683933 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:227624830-227624852
|
1:227624877-227624899
|
| Sequence |
CCCTGCCAGATCCAGAGGGATGG |
CAGCGATCAGCAGTGGTGGACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 13, 1: 43, 2: 96, 3: 162, 4: 295} |
{0: 1, 1: 12, 2: 60, 3: 127, 4: 244} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|