|
Left Crispr |
Right Crispr |
Crispr ID |
922683925 |
922683933 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:227624831-227624853
|
1:227624877-227624899
|
Sequence |
CCTGCCAGATCCAGAGGGATGGA |
CAGCGATCAGCAGTGGTGGACGG |
Strand |
- |
+ |
Off-target summary |
{0: 12, 1: 36, 2: 99, 3: 152, 4: 348} |
{0: 1, 1: 12, 2: 60, 3: 127, 4: 244} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|