|
Left Crispr |
Right Crispr |
| Crispr ID |
922781047 |
922781048 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:228252556-228252578
|
1:228252583-228252605
|
| Sequence |
CCAAGAGCTGTCTCTCAAAATGA |
AGTTATCTGCAGAAGATGACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 199, 2: 200, 3: 189, 4: 376} |
{0: 21, 1: 199, 2: 184, 3: 120, 4: 249} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|