ID: 922841139_922841142

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 922841139 922841142
Species Human (GRCh38) Human (GRCh38)
Location 1:228645407-228645429 1:228645421-228645443
Sequence CCTGGGCGTTCCGGGAGCGGGAA GAGCGGGAAGGCACCGCGAACGG
Strand - +
Off-target summary No data {0: 18, 1: 1, 2: 0, 3: 4, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!